Now seeing patientsLittle Rock · Searcy · Miami
Functional & hormone medicine in Little Rock, Searcy & Miami
Decode what your body has been telling you.
Fatigue that sleep doesn’t fix. Weight that won’t move. Mood, libido, focus. Dr. Emmanuel Tancinco reads your hormones, metabolism and labs as one connected system, then builds a physician-led program around what they show.
- ★★★★★ 5.0 · 7 Google reviews
- Cash-based · HSA/FSA · CareCredit
- Board-certified internist · ABIM
Symptom scan · does this sound like you?
Symptoms we evaluate
Many of our patients come to us feeling “off” even when routine labs look normal. Persistent fatigue, low mood or brain fog can have several causes, including hormonal and metabolic changes worth a closer look.
Your read
0 bp
— — —
Pick what you’ve been feeling. We’ll show which of the five programs your pattern most resembles, and you can bring it to a free 15-minute discovery call.
Our approach
When labs are normal, we look for other causes.
Many patients are told “your labs are normal” yet still struggle with fatigue, brain fog, weight gain, sleep problems, digestive issues, anxiety or unexplained inflammation. Normal results are reassuring, and they also tell us to look further: sleep, stress, nutrition, medications and the markers a routine panel leaves out.
- Advanced medical diagnostics
- Functional medicine and metabolic testing
- Personalized nutrition and supplementation
- Hormone therapy when clinically appropriate
- Lifestyle and stress-reduction strategies
Every plan is customized, science-based, and designed to support long-term health, not just short-term relief. How functional medicine works
Panel view · how we read results
Illustration
- Thyroid
- Sex hormones
- Blood sugar & insulin
- Inflammation
- Micronutrients
Not real patient data. In-range results point us to other causes; prescription treatment follows a clinical diagnosis, not a target number.
Five programs · 4 to 12 months
Wellness programs shaped around you.
Explore our physician-led programs, then use a discovery call to talk through your concerns, goals and where to begin. Individual evaluation guides the recommendation.
Hormonal Wellness
4 months · Hormone symptoms, no other conditions
ATGGTGATCACCGCCCTGATFocused hormone evaluation and care for symptoms such as fatigue, sleep changes, mood or low libido, for people without other medical conditions or weight concerns.
Vital Wellness
4 months · Hormone and weight concerns
ATGGTGATCACCGCCCTGATAn integrative, functional medicine plan for hormone and weight concerns in people without other medical conditions, with functional labs and a health coach.
Restore Wellness
6 months · Weight plus medical conditions
ATGGTGATCACCGCCCTGATTACTTACATGA six-month plan for hormone and weight concerns plus conditions such as high blood pressure, high cholesterol, diabetes, digestive issues or Hashimoto’s.
Longevity Wellness
9 months · Complex or ongoing concerns
ATGGTGATCACCGCCCTGATTACTTACATGGTGATCACCGCCCTGThe same depth as Restore, with nine months of physician oversight, coaching and follow-up for ongoing or complex health concerns.
Vibrant Wellness
12 months · Several conditions, longest support
ATGGTGATCACCGCCCTGATTACTTACATGGTGATCACCGCCCTGATTACTTACATGGTGTwelve months of personalized, physician-led care for several health issues at once, such as high blood pressure, diabetes, high cholesterol, hormonal disorders or difficulty losing weight.
Programs are tailored for women and men, and your evaluation decides which one fits.
Explore health topics
Hormone, metabolic and functional medicine care
- TACBioidentical hormone therapyHormone therapy for women and men, considered only when symptoms and testing show a clinical need.
- TTGMenopause & perimenopauseHot flashes, night sweats, broken sleep, cycle and mood changes.
- TATLow testosteroneEvaluation for low testosterone, with treatment only when testing confirms a deficiency.
- GCAThyroid & stressThyroid function, cortisol and the wired-but-tired pattern.
- CCAMedical weight lossA physician-supervised plan that looks at hormones and metabolism, not just calories.
- CAGMetabolic & lab testingHormones, metabolism, thyroid, micronutrients and inflammation: the baseline for every plan.
- GACFunctional medicineRoot-cause evaluation of chronic symptoms with systems-based assessment.
- ATGLongevity medicineA long-term plan for healthspan, built before problems start.
- ABIMBoard certified, American Board of Internal Medicine
- ABOMDiplomate, American Board of Obesity Medicine
- ABAARMDiplomate, American Board of Anti-Aging and Regenerative Medicine
- IFMTrained by the Institute for Functional Medicine (AFMCP)
Credentials & advanced training
Meet Dr. Emmanuel Tancinco, MD
Dr. Emmanuel Tancinco completed his internal medicine residency at the University of Arkansas for Medical Sciences and spent nearly two decades as an internist and hospitalist before focusing on functional, metabolic and hormone care. Every program is physician-led, with longer visits that leave time for listening, investigation and thoughtful evaluation.
Why patients choose us
In their words
5.0
7 Google reviews · Searcy profile
RoRo Arkansas★★★★★ · Google review I can’t say enough good things about him! He truly listens to your concerns and goals, takes an in-depth look at your bloodwork, and recommends additional testing when needed. What I appreciate most is that he doesn’t try to sell you a bunch of unnecessary supplements. He actually looks at what your body needs, explains why you may or may not need something, and helps simplify what you’re taking. He takes a functional approach to your health, can connect you with a dietitian covered by your insurance, and follows up with you. He’s always just a text away and genuinely wants to see you get better! He is such a great addition to the Searcy area, and I’m excited to see his practice continue to grow. It’s refreshing to find someone who truly cares about your health and not just selling you products. Highly recommend!
David Landers★★★★★ · Google review Dr. Tancinco has been a tremendous blessing on my health journey. He has been very thorough and knowledgeable about finding a baseline and crafting a plan to help me reach my goals. Dr. Tancinco has been a great mix of doctor and coach, reaching out and checking in and coaching along the way! The facilities are top notch! Could not recommend Dr. Tancinco more!
Philip Corder★★★★★ · Google review I’m a patient of Dr Noel Tancinco at Vital Longevity Clinic. I love the personal care and attention to detail I’ve received. I now have more energy, optimized nutrition, supplements that are tailored to my needs, and incredible personal professional medical advice. This isn’t a fix for things but more a big picture approach to living , healthier. I wish more Doctors and medical professionals took the time to help people like Dr Tancinco and his team at Vital Longevity Clinic have done for me. I cannot recommend any HIGHER. They have made a huge difference in my life.
Dana Worth★★★★★ · Google review Dr Tancinco is one of very best doctors. I have worked with him for years and found him to be very kind and attentive to the hospital staff and his patients. I am currently seeing him as a patient and he has gone over and beyond to assist me with my wellness journey. He listens attentively, reviewed all my medical history, and has done more for my wellness than any other doctor. As I have been going through this wellness journey, he takes the time to explain all the tests, test results, treatment plan , and always answers my questions. If you want to feel respected and reassured about your health journey, Dr Tancinco is your doctor!! He will take excellent care of you!!
Khiem Phan★★★★★ · Google review Very beautiful clinic and relaxing environment. Dr. Tancinco is super awesome; he is so ready to serve Searcy community.
Reviews are shared exactly as posted on Google and describe personal experiences, not typical or guaranteed results. Your plan depends on your own evaluation.
Three clinics · by appointment
Clinics in Little Rock, Searcy and Miami
Do you accept insurance?
We're a cash-based practice, which lets us offer longer visits, in-depth assessments and advanced testing that insurance typically doesn't cover. HSA/FSA cards are accepted where your plan allows, and CareCredit financing is available. See the payment FAQs.
What happens on the free discovery call?
It's a 15-minute conversation about your symptoms, goals and history. We explain how the wellness programs work and help you decide on a next step. There's no cost and no obligation.
What conditions do you help with?
Common reasons people come in include perimenopause and menopause, low testosterone, fatigue, weight gain and metabolic slowdown, brain fog, mood changes, poor sleep, low libido, PMS, PCOS and digestive symptoms. Start with the symptoms we evaluate.
What is functional medicine?
A personalized, science-based approach that looks for the root causes of symptoms rather than only managing them, recognizing that the body's systems are connected. Read more about functional medicine at Vital Longevity Clinic.
Who is the doctor at Vital Longevity Clinic?
Care is led by Dr. Emmanuel Tancinco, MD, a board-certified internist (ABIM) and diplomate of the American Board of Obesity Medicine, with nearly two decades in internal medicine and training through the Institute for Functional Medicine. He reviews your history and labs and sets the medical direction of every plan.
Do you offer telehealth visits?
No. All medical care is provided in person at our offices in Little Rock, Searcy and Miami. The free 15-minute discovery call is a conversation about your goals, not a medical visit, diagnosis or prescription.
How is this different from my primary care doctor?
Primary care is built for screening and short visits. Our visits are longer and look at how hormones, metabolism, thyroid, sleep and stress fit together, with broader lab testing when it's warranted. We work alongside your primary care doctor rather than replacing them, and urgent or emergency concerns still belong with them or with 911.
Which location should I choose?
We see patients by appointment in Little Rock, Searcy and Miami. Pick whichever is easiest to reach; your discovery call is the same either way.
Your first step
Start with a free 15-minute discovery call.
- Step 1Free 15-minute discovery callTell us what's going on. We'll explain how the programs work and whether we're a fit.
- Step 2Evaluation and advanced labsHormones, metabolism, thyroid, micronutrients and inflammation, plus your full history.
- Step 3Physician review and your planDr. Tancinco reads the results with you and recommends a program built around them.
Prefer to call? Arkansas 501-254-9650 · Miami 786-473-4815
Cash-based practice: we don't bill insurance. HSA/FSA cards (where your plan allows) and CareCredit financing are accepted.
Discovery call request
Free · 15 min · no obligation